Numerade

Questions asked

BEST MATCH

6. Repeat the previous problem, solving for Vx using the branch current method. + Vx - 20 $$\Omega$$ 10 V 30 $$\Omega$$ 20 $$\Omega$$ 5 $$\Omega$$ 2 A

View Answer

BEST MATCH

Figure 5-2 Price $20- 18- 16- 12 10 100 200 300 400 500 600 Quantity 10. Refer to Figure 5-2. The price elasticity of demand between point A and point B, using the midpoint method, is a. 1. b. 1.5. c. 2. d. 2.5. 11. Refer to Figure 5-2. The elasticity of demand between point B and point C, using the midpoint method, is a. 0.5. b. 0.75. c. 1.0. d. 1.3. 12. Refer to Figure 5-2. If the price decreased from $18 to $6, a. total revenue would increase by $1,200 and demand is elastic between points A and C. b. total revenue would increase by $800 and demand is elastic between points A and C. c. total revenue would decrease by $1,200 and demand is inelastic between points A and C. d. total revenue would decrease by $800 and demand is inelastic between points A and C. 13. Refer to Figure 5-2. Sellers' total revenue would increase if the price a. increased from $4 to $6. b. increased from $16 to $18. c. decreased from $8 to $6.

View Answer

BEST MATCH

Life insurance proceeds paid in full upon the insured's death are: Taxable Not taxable

View Answer

BEST MATCH

What distinguishes Obsessive Compulsive Personality Disorder (OCPD) from Obsessive Compulsive Disorder is that with OCPD ______. Question 40 options: true obsessions and compulsions are rare. rituals are rare. they are not perfectionistic. they are not rigid in their thinking or behaving.

View Answer

BEST MATCH

Jeffery Sachs believes in the concept of poverty Trap ans foreign aid. True or false

View Answer

BEST MATCH

How does Facebook's F4 increase storage efficiency and remain fault tolerant? (A) Warm blobs are separated from hot blobs for more efficient replication (B) Two replicas of each volume are on same racks in the same data center, while the third replica is in another datacenter (C) XOR coding is used to handle datacenter failures and Reed-Solomon coding for rack, host and disk failures (D) F4 only needs storage- heavy nodes but no CPU-heavy nodes

View Answer

BEST MATCH

Suppose the relative demand for European products goes down. The real exchange rate, q$/€, ____, and the dollar ____. A. Increases; depreciates B. Decreases; appreciates C. Increases; appreciates D. Decreases; depreciates

View Answer

BEST MATCH

You plan to deploy a Windows 11 image. The deployment must meet the following requirements: Use the Microsoft Deployment Toolkit (MDT). Require a user to initiate the installation. Require a user to enter the computer name during the deployment. Your company does NOT have Configuration Manager deployed. What type of deployment method will you use?

View Answer

BEST MATCH

17) Synthesis of the mRNA starts at the boxed A/T base pair indicated by the box and proceeds left to right on the sequence below. Transcribe and translate this bacterial gene. 5'-GGACCGCGGGGOAGGATTGCTCCGGGCTGTTTCATGACTTGTCAGGTGGGATGACTTGGATGGAAAAGTAGAAGGTCATG-3' 1 -+80 3'-CCTGGCGCCCCCTCCTAACGAGGCCCGACAAAGTACTGAACAGTCCACCCTACTGAACCTACCTTTTCATCTTCCAGTAC-5' 18) Part of a gene is written below, and transcription begins at the boxed T/A base pair and proceeds from left to right. (this one is hard, and I won't ask you to do any splicing, but it is doable and you might enjoy the challenge) 5'-CCGATATAATGAGTCGTCGTCTGGGCCTTCATGTATTCATGGGAAGAGAGTGTAATGTTTGCCTAAGGCC -3' 1 --+70 3'-GGCTATATTACTCAGCAGCAGACCCGGAAGTACATAAGTACCCTTCTCTCACATTACAAACGGATTCCGG -5' a) Draw a green box around the promoter. QUIZ REVIEW b) Label the template strand of the DNA on the sequence above. c) Write the sequence of the pre-mRNA. d) This gene has a small intron and the intron splice sites has the composition 5'-GUG-3' (for the 5' splice site) and 5'-UUG-3' (for the 3' splice site), meaning that these sequences and everything between them will be removed from the mature mRNA. -Draw a box around the intron on the DNA sequence above. e) Write the sequence of the peptide that is translated from the mature mRNA and label the directionality of the peptide. f) Imagine that, in the process of DNA replication, the 39th base in the gene (with the") was changed from A/T to C/G. What would be the effect of this mutation on the produced peptide?

View Answer

BEST MATCH

The given family of functions is the general solution of the differential equation on the indicated interval. Find a member of the family that is a solution of the initial-value problem. y(x) = c1e^(4x) + c2e^(-x), (-π, π), y'' - 3y' - 4y = 0, y(0) = 1, y'(0) = 2

View Answer

edward h.