the text provided does not contain any spelling typographical grammatical ocr or mathematical er

Name: the text provided does not contain any spelling typographical grammatical ocr or mathematical errors 53132
Uploaded: 2022-06-13T06:29:48-08:00
Duration: 2 min 42 s
Channel: Adi S
Description: the text provided does not contain any spelling typographical grammatical ocr or mathematical errors 53132

Step 1: Read the text carefully to identify any errors or issues.

The text provided does not contain any spelling...

Labs

Want to see this concept in action?

NEW

Explore this concept interactively to see how it behaves as you change inputs.

View Labs

Recommended Videos

29-the-following-dna-sequence-sequence-for-the-was-extracted-from-a-genbank-database-and-contains-the-nucleotide-human-beta-globin-gene-nucleotide-look-carefully-to-understand-how-the-positi-64894

29. The following DNA sequence was extracted from a GenBank database and contains the nucleotide sequence for the human beta globin gene. Look carefully to understand how the position of each nucleotide is determined by a number. The number at the beginning of each line corresponds to the first nucleotide in that line. Find the nucleotide that begins the beta globin sequence: 62187, and circle this nucleotide in the sequence below. beta globin is coded for in the region: 62187-63610 62161 ttcactagca acctcaaaca gacaccatgg tgcacctgac tcctgaggag aagtctgccg 62221 ttactgccct gtggggcaag gtgaacgtgg atgaagttgg tggtgaggcc ctgggcaggt 62281 tggtatcaag gttacaagac aggtttaagg gaccaatag aaactgggca tgtggagaca 62341 gagaagactc ttgggtttct gataggcact gactctctct gcctattggt ctattttccc 62401 acccttaggc tgctggtggt ctacccttgg acccagaggt tctttgagtc ctttggggat 62461 ctgtccactc ctgatgctgt tatgggcaac cctaaggtga aggctcatgg caagaaagtg 62521 ctcggtgcct ttagtgatgg cctggctcac ctggacaacc tcaagggcac ctttgccaca 62581 ctgagtgagc tgcactgtga caagctgcac gtggatcctg agaacttcag ggtgagtcta 62641 tgggaccctt gatgttttct ttccccttct tttctatggt taagttcatg tcataggaag 62701 gggagaagta acagggtaca gtttagaatg ggaaacagac gaatgattgc atcagtgtgg 62761 aagtctcagg atcgttttag tttcttttat ttgctgttca taacaattgt tttcttttgt 62821 ttaattcttg ctttcttttt ttttcttctc cgcaattttt actattatac ttaatgcctt 62881 aacattgtgt ataacaaaag gaaatatctc tgagatacat taagtaactt aaaaaaaaac 62941 tttacacagt ctgcctagta cattactatt tggaatatat gtgtgcttat ttgcatattc 63001 ataatctccc tactttattt tcttttattt ttaattgata cataatcatt atacatattt 63061 atgggttaaa gtgtaatgtt ttaatatgtg tacacatatt gaccaaatca gggtaatttt 63121 gcatttgtaa ttttaaaaaa tgctttcttc ttttaatata cttttttgtt tatcttattt 63181 ctaatacttt ccctaatctc tttctttcag ggcaataatg atacaatgta tcatgcctct 63241 ttgcaccatt ctaaagaata acagtgataa tttctgggtt aaggcaatag caatatttct 63301 gcatataaat atttctgcat ataaattgta actgatgtaa gaggtttcat attgctaata 63361 gcagctacaa tccagctacc ttctgcttt tattttatgg ttgggataag gctggattat 63421 tctgagtcca agctaggccc ttttgctaat catgttcata cctcttatct tcctcccaca 63481 gctcctgggc aacgtgctgg tctgtgtgct ggcccatcac tttggcaaag aattcacccc 63541 accagtgcag gctgcctatc agaaagtggt ggctggtgtg gctaatgccc tggcccacaa 63601 gtatcactaa gctcgctttc ttgctgtcca atttctatta aaggttcctt tgttccctaa 63661 gtccaactac taaactgggg gatattatga agggccttga gcatctggat tctgcctaat 30. How many nucleotides are represented in a single line? How many nucleotides does this sequence contain in its entirety (from beginning to end)? 31. The sequence above includes the beta globin gene, which lies between nucleotides 62187 and 63610. Find and circle both the first and the last base of the beta globin gene. How many nucleotides are in the beta globin gene? 32. If there are 146 amino acids in a beta globin polypeptide, how many of these nucleotides belong to noncoding sequences?

Adi S.

transcription-translation-scrmcnt-dna-that-contain-intonmatianoror-codes-panticu-n-rna-molecule-basc-sr-quencc-gene-copied-in-prottin-process-ol-the-informnation-contalned-the-form-gcncconta-07966

Transcription & Translation A ________ is a segment of DNA that contains information for or "codes" for a particular RNA molecule or protein. In the process of ________, the information contained in the base sequence of a gene is copied in the form of ________. Genes contain three regions: ________, ________, and ________ regions. In prokaryotes, the promoter contains ________ & ________ boxes that are required for initiation of transcription. ________ binds to these regions of the promoter, recruiting RNA polymerase to the gene. In eukaryotes, the basal transcription machinery binds to the ________ box within the promoter. The formation of mRNA, a single stranded/double stranded (circle one) molecule, is catalyzed by ________. Transcription of a eukaryotic gene is terminated when the ________ signal is transcribed. In prokaryotes, transcription and translation (the production of ________) is simultaneous whereas in eukaryotes, the mRNA is first ________. In eukaryotic mRNA, ________ are removed and a 5' ________ is added for ________ recognition. Multiple proteins may be produced from a single eukaryotic pre-mRNA due to ________. In the process of translation, protein is produced by ________ found in the cytoplasm or associated with the ________. ________s bring the correct amino acids to the ribosomes by complimentary bonding between this molecule's ________ and the codon of mRNA. The same tRNA can bind to multiple codons by "wobbling" at the ________ base position. The process of protein production is catalyzed by ________. In translation initiation, the ________ ribosomal subunit the mRNA and binds. A tRNA with the amino acid ________ "sticks" to the ________ codon. The large ribosomal subunit then assembles with the starter tRNA in the A/P/E site (circle one). Another tRNA enters the A/P/E site (circle one), bringing with it the correct amino acid. A ________ bond is formed between the amino acid that just entered the ribosome and the amino acid held by the starter tRNA in the process of ________. The ribosome then ________ and the tRNA now without an amino acid enters the A/P/E site (circle one). With the next translocation, a new tRNA enters the A/P/E site (circle one), the growing polypeptide chain attached to the tRNA in the A/P/E site (circle one) is transferred the new tRNA and the tRNA without an amino acid in the A/P/E (circle one) leaves the ribosome. This process is repeated until a ________ codon is reached which causes a ________ factor to bind to the A site. The newly made protein and ribosomal subunits are then released/disassemble. In the process of translation, single/multiple (circle one) molecules of a particular protein can be made from an mRNA molecule. Cells look/act differently from other cell types within an organism due to ________ expression. Expression of particular genes is influenced by multiple factors. One of which is ________ remodeling. If a gene is in a region that is condensed/de-condensed (circle one) it has the potential to be transcriptionally active. The enzyme ________ adds ________ to histone groups to loosen the chromatin structure, making that region be active/inactive (circle one) transcriptionally. ________ removes the histone

Sri K.

below-is-part-of-a-genes-dna-sequence-no-promoter-introns-o-terminator-are-shown-tacgatgattcgtaggtatttacgcaggggctaagggcagacgggaaactagcgaacc-3-atgctactaagcatccataaatgcgtccccgattcccgtctgcccttt-77055

Below is part of a gene's DNA sequence (no promoter, introns or terminator are shown). 5' TACGATGATTCGTAGGTATTTACGCAGGGGCTAAGGGCAGACGGGAAACTAGCGAACC 3' 3' ATGCTACTAAGCATCCATAAATGCGTCCCCGATTCCCGTCTGCCCTTTGATCGCTTGG 5' * * (a) Identify and label the template and coding strands on the DNA. How did you determine this? Draw an arrow that indicates the direction of transcription. (b) If the *s indicate the start point and the end point in transcription, what is the resulting mRNA sequence? When you have finished transcribing, draw a box around the start codon and the stop codon. Underline the 5'UTR and the 3'UTR. (c) Using the mRNA sequence in (b), number and mark the triplet codons present in the mRNA sequence, beginning with the start codon. How many codons are present? (d) Using the mRNA sequence you transcribed, write the complete amino acid sequence of the polypeptide translated from this mRNA. How many amino acids are in this sequence? (e) Consider codons #3, #4 and #5 (start codon is #1) in the mRNA sequence. During elongation, imagine that the ribosome is positioned at these three codons with #3 in the E site, #4 in the P site and #5 in the A site (what do E, P, and A stand for? Draw the tRNAs that will be in each of these sites - E, P, and A showing the anticodon and the amino acid (if any) that is attached to the tRNA. Show the tRNA and its attachment as illustrated in the example on the back: Example: codon # 5 is UAU, therefore the tRNA in the A site can be illustrated this way: Tyr | A U A In the same way, illustrate the tRNAs in the E and the P site for codons #3 and #4. Keep in mind the positions of amino acids during the elongation process for sites E and P. (f) A mutation is produced in the above DNA sequence such that the codon ATC on the DNA template strand is mutated to TTC in the DNA. Write down the new mRNA sequence and the new amino acid sequence that results from such a mutation. What type of mutation (silent – no effect, nonsense or missense) is this? (g) Consider the same DNA sequence above. In reality it does not include some parts of the DNA. Which parts are missing on this DNA sequence? How would the mRNA sequence be different in eukaryotes vs prokaryotes?

Sri K.