lets stimulate a point mutation at the 21st base. It was accidentally changed during replication
Added by Glenda E.
Step 1
For example, if the original sequence was "ATCGATCGATCGATCGATCGA", the nucleotide at the 21st base would be "G". Show more…
Show all steps
Your feedback will help us improve your experience
Jhankar T and 56 other Biology educators are ready to help you.
Ask a new question
Labs
Want to see this concept in action?
Explore this concept interactively to see how it behaves as you change inputs.
Key Concepts
Recommended Videos
In the first mutation, you simulated a point mutation by changing the 9th nucleotide in your strand from T to G. What type of mutation was this? neutral point mutation missense point mutation nonsense point mutation None of the above.
Jhankar T.
If a base-pair change occurs during DNA replication, this is a mutation. would be a mutation only if it falls in a protein-coding part of a gene. would be a mutation only if it falls in a transcribed part of the genome. is not a mutation, because only one base pair has been altered.
Jonathan T.
point mutation
Asma V.
Recommended Textbooks
Biology for AP Courses
Objective Biology for NEET
Introduction to General, Organic and Biochemistry
Transcript
Watch the video solution with this free unlock.
EMAIL
PASSWORD