For the DNA sequence AATGTCATTGC, what will be the equivalent code for the complementary RNA sequence?
Added by David A.
Step 1
The complementary DNA sequence for AATGTCATTGC is TTACAGTAACG. Show more…
Show all steps
Your feedback will help us improve your experience
Adi S and 57 other Biology educators are ready to help you.
Ask a new question
Labs
Want to see this concept in action?
Explore this concept interactively to see how it behaves as you change inputs.
Key Concepts
Recommended Videos
What is the complementary messenger RNA sequence for the DNA sequence shown below? CAAGGT
Adi S.
Write the complementary mRNA sequence for the DNA sequence given here: TACCGGACCCACGTAAATCGGCCC
If a DNA molecule comprised the following sequence, what would be the complementary sequence? If the DNA sequence was transcribed to RNA, what would be the mRNA sequence? 5'-ATGCAACGCTTCAAGATAGGCATCTAA-3
Madhur L.
Recommended Textbooks
Biology for AP Courses
Objective Biology for NEET
Introduction to General, Organic and Biochemistry
Transcript
Watch the video solution with this free unlock.
EMAIL
PASSWORD